Bilimde son nokta!

Bilimsel gelişmeler ışığında artık her türlü bilgiye DNA aracılığıyla ulaşılıyor. Peki, ölüleri konuşturan bu DNA şifresi nasıl çalışıyor. İşte cevabı...

Bilim & Teknoloji 03.11.2015, 13:10 03.11.2015, 12:12
Bilimde son nokta!

Turgut Özal Üniversitesi'nden Doç. Dr. Kadir Demircan DNA hakkında bilinmeleri anlattı.

DNA, adli ve kriminal olayların çözümünde bir numaralı anahtar vazifesi görüyor. Ölüleri bile konuşturmayı, dilinden anlayanlara derdini anlattırmayı başaran DNA'nın nasıl şifrelendiğini ve insan hayatındaki yerini Doç. Dr. Kadir Demircan anlattı.
Ülkehaber'den İlkay Yaprak'a konuşan Doç. Dr. Kadir Demircan DNA'nın ana yapısını anlatttı. Demircan, bu çalışmaları 'Ölüler konuşamaz ama sır da saklamazlar' sözleriyle değerlendirdi.

İşte Demircan'ın sözleri:


DNA’yı notalara benzetirsek herkeste bu notaların yorumlanması farklıdır. DNA, hücrelerimizin çekirdeğinde yerleşik kimyasal bir molekül. 4 harften oluşan bir şifreyi içeriyor. A, T, C ve G. Sizde AATTTTGGGGCTATCGGGGGGGGAATTTTTTCTC diye bende AATTTTGGGGCTATCGGGGGGGGAATTTTTTAAA şeklinde.
KİŞİLER KODLANMIŞ DURUMDA


Bende sadece son üç harf farklı. İnsanda bu harf sayısı 3 milyardan fazla. Bu farklılıklar bireysel farklarımızı ortaya çıkarıyor. İnsanlarda bu dizilim benzerliği yüzde 90 dan fazla. Aynı notalarla yazılmış güfteleriz. Ama iş icra ve seslendirmeye gelince sorunuzun cevabı orda saklı. Bu şifreleri deşifre edersek diyor ki bu kişinin saç rengi siyah, onun ki sarı, ötekinin ki kumral….

7 MİLYAR İNSANIN HİÇBİRİ BİRBİRİNE BENZEMİYOR


Bu bilgiler kodlanmış durumda. Genlerin yaptığı bunlarla ilgili proteinlerin üretimi. Ama farklı renk ve tondaki kişiler evlenince bunların karışımı ortaya çıkıyor. Orda hangi notanın icrası güçlüyse çocukda o baskın oluyor. Sonuçta bu kombinasyonlar trilyonlarca oluyor. 7 milyar insanın hiçbiri birbirine benzemiyor.
ADLİ OLAYLARDA GİZEMİ ORTADAN KALDIRIYOR


Genler; yüz hatlarımızı, saç/deri/göz rengimizi, alkole dayanıklılığımızı, parmak izlerimizi, kan gruplarımızı yani bizi biz yapan vücudumuzdaki binlerce proteinin üretilmesini sağlayan şifreleri üzerinde barındırıyorlar.

Adli bilimlerde ise gizemleri ortadan kaldıran bir yardımcı haline dönüşüyor DNA. Suçlunun olay yerine bıraktığı kan, tükrük, saç ve eşyaları onu ele veriyor. Çünkü DNA onun adına konuşuyor. Ölüler konuşamaz ama sır da saklamazlar. Medyaya yansımayan yaşanmış nice detektif hikayeleri vardır.


ÖLÜLER KONUŞUYOR AMA...



Ölüler konuşmuyor ama onların vücudundaki DNA molekülü onlar adına konuşuyor. Babalığın belirlenmesi için eskiden baba ve çocuk çok sayıda kişinin önüne oturuyor, el ayak ve yüzüne bakılarak benziyorsa baba olabilir deniliyordu. 1900 yılında kan grupları babalık davasında kullanılmaya başlandı.

DNA GÜÇLÜ BİR TANIK


1985 yılından sonra ise genetik belirteçler devreye girdi. DNA, sessiz ama güçlü bir tanıktır. Silent Witness. Mandelanın rakibi olan ve G. Afrikada görülen Botha davasında olduğu gibi 300 yıl önceki bir olayı aydınlatabilir. Nobel ödüllü James Watson, Afrikalıların değersiz ve düşük bir ırk olduğunu söyledi.


DNA'MIZ GERÇEKLERİ HAYKIRIYOR


Ama onun DNA’sı kendisinin köklerinin Afrika’dan geldiğini gösterince sesi kesildi! Artık elimizde X kromozomu, Y kromozomu ve mitokondri DNA’sı gibi ölüleri konuşturan, davaları aydınlatan çok güçlü sessiz genetik tanıklarımız var. Biz yalan veya çelişkili konuşsak bile DNA’mız gerçekleri haykırıyor.


Yorumlar (0)
15
açık
Günün Anketi Tümü
En Çok Sevdiğiniz Renk Hangisi?
Namaz Vakti 19 Mayıs 2021
İmsak 03:47
Güneş 05:36
Öğle 13:06
İkindi 17:02
Akşam 20:25
Yatsı 22:06
Puan Durumu
Takımlar O P
1. Beşiktaş 40 84
2. Galatasaray 40 84
3. Fenerbahçe 40 82
4. Trabzonspor 40 71
5. Sivasspor 40 65
6. Hatayspor 40 61
7. Alanyaspor 40 60
8. Karagümrük 40 60
9. Gaziantep FK 40 58
10. Göztepe 40 51
11. Konyaspor 40 50
12. Başakşehir 40 48
13. Rizespor 40 48
14. Kasımpaşa 40 46
15. Malatyaspor 40 45
16. Antalyaspor 40 44
17. Kayserispor 40 41
18. Erzurumspor 40 40
19. Ankaragücü 40 38
20. Gençlerbirliği 40 38
21. Denizlispor 40 28
Takımlar O P
1. Adana Demirspor 34 70
2. Giresunspor 34 70
3. Samsunspor 34 70
4. İstanbulspor 34 64
5. Altay 34 63
6. Altınordu 34 60
7. Ankara Keçiörengücü 34 58
8. Ümraniye 34 51
9. Tuzlaspor 34 47
10. Bursaspor 34 46
11. Bandırmaspor 34 42
12. Boluspor 34 42
13. Balıkesirspor 34 35
14. Adanaspor 34 34
15. Menemenspor 34 34
16. Akhisar Bld.Spor 34 30
17. Ankaraspor 34 26
18. Eskişehirspor 34 8
Takımlar O P
1. Man City 37 83
2. M. United 37 71
3. Chelsea 37 67
4. Leicester City 37 66
5. Liverpool 36 63
6. Tottenham 36 59
7. West Ham 36 59
8. Leeds United 37 56
9. Everton 36 56
10. Arsenal 36 55
11. Aston Villa 36 49
12. Wolverhampton 36 45
13. Crystal Palace 36 44
14. Southampton 37 43
15. Brighton 37 41
16. Burnley 36 39
17. Newcastle 36 39
18. Fulham 37 28
19. West Bromwich 36 26
20. Sheffield United 36 20
Takımlar O P
1. Atletico Madrid 37 83
2. Real Madrid 37 81
3. Barcelona 37 76
4. Sevilla 37 74
5. Real Sociedad 37 59
6. Real Betis 37 58
7. Villarreal 37 58
8. Celta de Vigo 37 53
9. Athletic Bilbao 37 46
10. Granada 37 45
11. Osasuna 37 44
12. Cádiz 37 43
13. Valencia 37 42
14. Levante 37 40
15. Deportivo Alaves 37 38
16. Getafe 37 37
17. Huesca 37 33
18. Elche 37 33
19. Real Valladolid 37 31
20. Eibar 37 30