Bilimde son nokta!

Bilimsel gelişmeler ışığında artık her türlü bilgiye DNA aracılığıyla ulaşılıyor. Peki, ölüleri konuşturan bu DNA şifresi nasıl çalışıyor. İşte cevabı...

Bilim & Teknoloji 03.11.2015, 13:10 03.11.2015, 12:12 Emre
Bilimde son nokta!

Turgut Özal Üniversitesi'nden Doç. Dr. Kadir Demircan DNA hakkında bilinmeleri anlattı.

DNA, adli ve kriminal olayların çözümünde bir numaralı anahtar vazifesi görüyor. Ölüleri bile konuşturmayı, dilinden anlayanlara derdini anlattırmayı başaran DNA'nın nasıl şifrelendiğini ve insan hayatındaki yerini Doç. Dr. Kadir Demircan anlattı.
Ülkehaber'den İlkay Yaprak'a konuşan Doç. Dr. Kadir Demircan DNA'nın ana yapısını anlatttı. Demircan, bu çalışmaları 'Ölüler konuşamaz ama sır da saklamazlar' sözleriyle değerlendirdi.

İşte Demircan'ın sözleri:


DNA’yı notalara benzetirsek herkeste bu notaların yorumlanması farklıdır. DNA, hücrelerimizin çekirdeğinde yerleşik kimyasal bir molekül. 4 harften oluşan bir şifreyi içeriyor. A, T, C ve G. Sizde AATTTTGGGGCTATCGGGGGGGGAATTTTTTCTC diye bende AATTTTGGGGCTATCGGGGGGGGAATTTTTTAAA şeklinde.
KİŞİLER KODLANMIŞ DURUMDA


Bende sadece son üç harf farklı. İnsanda bu harf sayısı 3 milyardan fazla. Bu farklılıklar bireysel farklarımızı ortaya çıkarıyor. İnsanlarda bu dizilim benzerliği yüzde 90 dan fazla. Aynı notalarla yazılmış güfteleriz. Ama iş icra ve seslendirmeye gelince sorunuzun cevabı orda saklı. Bu şifreleri deşifre edersek diyor ki bu kişinin saç rengi siyah, onun ki sarı, ötekinin ki kumral….

7 MİLYAR İNSANIN HİÇBİRİ BİRBİRİNE BENZEMİYOR


Bu bilgiler kodlanmış durumda. Genlerin yaptığı bunlarla ilgili proteinlerin üretimi. Ama farklı renk ve tondaki kişiler evlenince bunların karışımı ortaya çıkıyor. Orda hangi notanın icrası güçlüyse çocukda o baskın oluyor. Sonuçta bu kombinasyonlar trilyonlarca oluyor. 7 milyar insanın hiçbiri birbirine benzemiyor.
ADLİ OLAYLARDA GİZEMİ ORTADAN KALDIRIYOR


Genler; yüz hatlarımızı, saç/deri/göz rengimizi, alkole dayanıklılığımızı, parmak izlerimizi, kan gruplarımızı yani bizi biz yapan vücudumuzdaki binlerce proteinin üretilmesini sağlayan şifreleri üzerinde barındırıyorlar.

Adli bilimlerde ise gizemleri ortadan kaldıran bir yardımcı haline dönüşüyor DNA. Suçlunun olay yerine bıraktığı kan, tükrük, saç ve eşyaları onu ele veriyor. Çünkü DNA onun adına konuşuyor. Ölüler konuşamaz ama sır da saklamazlar. Medyaya yansımayan yaşanmış nice detektif hikayeleri vardır.


ÖLÜLER KONUŞUYOR AMA...



Ölüler konuşmuyor ama onların vücudundaki DNA molekülü onlar adına konuşuyor. Babalığın belirlenmesi için eskiden baba ve çocuk çok sayıda kişinin önüne oturuyor, el ayak ve yüzüne bakılarak benziyorsa baba olabilir deniliyordu. 1900 yılında kan grupları babalık davasında kullanılmaya başlandı.

DNA GÜÇLÜ BİR TANIK


1985 yılından sonra ise genetik belirteçler devreye girdi. DNA, sessiz ama güçlü bir tanıktır. Silent Witness. Mandelanın rakibi olan ve G. Afrikada görülen Botha davasında olduğu gibi 300 yıl önceki bir olayı aydınlatabilir. Nobel ödüllü James Watson, Afrikalıların değersiz ve düşük bir ırk olduğunu söyledi.


DNA'MIZ GERÇEKLERİ HAYKIRIYOR


Ama onun DNA’sı kendisinin köklerinin Afrika’dan geldiğini gösterince sesi kesildi! Artık elimizde X kromozomu, Y kromozomu ve mitokondri DNA’sı gibi ölüleri konuşturan, davaları aydınlatan çok güçlü sessiz genetik tanıklarımız var. Biz yalan veya çelişkili konuşsak bile DNA’mız gerçekleri haykırıyor.


Yorumlar (0)
21
açık
Günün Anketi Tümü
En Çok Sevdiğiniz Renk Hangisi?
Namaz Vakti 26 Haziran 2022
İmsak 03:26
Güneş 05:26
Öğle 13:12
İkindi 17:12
Akşam 20:47
Yatsı 22:39
Puan Durumu
Takımlar O P
1. Trabzonspor 38 81
2. Fenerbahçe 38 73
3. Konyaspor 38 68
4. Başakşehir 38 65
5. Alanyaspor 38 64
6. Beşiktaş 38 59
7. Antalyaspor 38 59
8. Karagümrük 38 57
9. Adana Demirspor 38 55
10. Sivasspor 38 54
11. Kasımpaşa 38 53
12. Hatayspor 38 53
13. Galatasaray 38 52
14. Kayserispor 38 47
15. Gaziantep FK 38 46
16. Giresunspor 38 45
17. Rizespor 38 36
18. Altay 38 34
19. Göztepe 38 28
20. Ö.K Yeni Malatya 38 20
Takımlar O P
1. Ankaragücü 36 70
2. Ümraniye 36 70
3. Bandırmaspor 36 62
4. İstanbulspor 36 60
5. Erzurumspor 36 58
6. Eyüpspor 36 57
7. Samsunspor 36 51
8. Boluspor 36 50
9. Manisa Futbol Kulübü 36 49
10. Tuzlaspor 36 49
11. Denizlispor 36 49
12. Keçiörengücü 36 48
13. Gençlerbirliği 36 48
14. Altınordu 36 45
15. Adanaspor 36 45
16. Kocaelispor 36 44
17. Bursaspor 36 44
18. Menemen Belediyespor 36 38
19. Balıkesirspor 36 12
Takımlar O P
1. M.City 38 93
2. Liverpool 38 92
3. Chelsea 38 74
4. Tottenham 38 71
5. Arsenal 38 69
6. M. United 38 58
7. West Ham United 38 56
8. Leicester City 38 52
9. Brighton 38 51
10. Wolverhampton Wanderers 38 51
11. Newcastle 38 49
12. Crystal Palace 38 48
13. Brentford 38 46
14. Aston Villa 38 45
15. Southampton 38 40
16. Everton 38 39
17. Leeds United 38 38
18. Burnley 38 35
19. Watford 38 23
20. Norwich City 38 22
Takımlar O P
1. Real Madrid 38 86
2. Barcelona 38 73
3. Atletico Madrid 38 71
4. Sevilla 38 70
5. Real Betis 38 65
6. Real Sociedad 38 62
7. Villarreal 38 59
8. Athletic Bilbao 38 55
9. Valencia 38 48
10. Osasuna 38 47
11. Celta Vigo 38 46
12. Rayo Vallecano 38 42
13. Elche 38 42
14. Espanyol 38 42
15. Getafe 38 39
16. Mallorca 38 39
17. Cadiz 38 39
18. Granada 38 38
19. Levante 38 35
20. Deportivo Alaves 38 31