Bilimde son nokta!

Bilimsel gelişmeler ışığında artık her türlü bilgiye DNA aracılığıyla ulaşılıyor. Peki, ölüleri konuşturan bu DNA şifresi nasıl çalışıyor. İşte cevabı...

Bilim & Teknoloji 03.11.2015, 13:10 03.11.2015, 12:12
16
Bilimde son nokta!
Turgut Özal Üniversitesi'nden Doç. Dr. Kadir Demircan DNA hakkında bilinmeleri anlattı.

DNA, adli ve kriminal olayların çözümünde bir numaralı anahtar vazifesi görüyor. Ölüleri bile konuşturmayı, dilinden anlayanlara derdini anlattırmayı başaran DNA'nın nasıl şifrelendiğini ve insan hayatındaki yerini Doç. Dr. Kadir Demircan anlattı.
Ülkehaber'den İlkay Yaprak'a konuşan Doç. Dr. Kadir Demircan DNA'nın ana yapısını anlatttı. Demircan, bu çalışmaları 'Ölüler konuşamaz ama sır da saklamazlar' sözleriyle değerlendirdi.

İşte Demircan'ın sözleri:

DNA’yı notalara benzetirsek herkeste bu notaların yorumlanması farklıdır. DNA, hücrelerimizin çekirdeğinde yerleşik kimyasal bir molekül. 4 harften oluşan bir şifreyi içeriyor. A, T, C ve G. Sizde AATTTTGGGGCTATCGGGGGGGGAATTTTTTCTC diye bende AATTTTGGGGCTATCGGGGGGGGAATTTTTTAAA şeklinde.
KİŞİLER KODLANMIŞ DURUMDA

Bende sadece son üç harf farklı. İnsanda bu harf sayısı 3 milyardan fazla. Bu farklılıklar bireysel farklarımızı ortaya çıkarıyor. İnsanlarda bu dizilim benzerliği yüzde 90 dan fazla. Aynı notalarla yazılmış güfteleriz. Ama iş icra ve seslendirmeye gelince sorunuzun cevabı orda saklı. Bu şifreleri deşifre edersek diyor ki bu kişinin saç rengi siyah, onun ki sarı, ötekinin ki kumral….

7 MİLYAR İNSANIN HİÇBİRİ BİRBİRİNE BENZEMİYOR

Bu bilgiler kodlanmış durumda. Genlerin yaptığı bunlarla ilgili proteinlerin üretimi. Ama farklı renk ve tondaki kişiler evlenince bunların karışımı ortaya çıkıyor. Orda hangi notanın icrası güçlüyse çocukda o baskın oluyor. Sonuçta bu kombinasyonlar trilyonlarca oluyor. 7 milyar insanın hiçbiri birbirine benzemiyor.
ADLİ OLAYLARDA GİZEMİ ORTADAN KALDIRIYOR

Genler; yüz hatlarımızı, saç/deri/göz rengimizi, alkole dayanıklılığımızı, parmak izlerimizi, kan gruplarımızı yani bizi biz yapan vücudumuzdaki binlerce proteinin üretilmesini sağlayan şifreleri üzerinde barındırıyorlar.

Adli bilimlerde ise gizemleri ortadan kaldıran bir yardımcı haline dönüşüyor DNA. Suçlunun olay yerine bıraktığı kan, tükrük, saç ve eşyaları onu ele veriyor. Çünkü DNA onun adına konuşuyor. Ölüler konuşamaz ama sır da saklamazlar. Medyaya yansımayan yaşanmış nice detektif hikayeleri vardır.

ÖLÜLER KONUŞUYOR AMA...


Ölüler konuşmuyor ama onların vücudundaki DNA molekülü onlar adına konuşuyor. Babalığın belirlenmesi için eskiden baba ve çocuk çok sayıda kişinin önüne oturuyor, el ayak ve yüzüne bakılarak benziyorsa baba olabilir deniliyordu. 1900 yılında kan grupları babalık davasında kullanılmaya başlandı.

DNA GÜÇLÜ BİR TANIK

1985 yılından sonra ise genetik belirteçler devreye girdi. DNA, sessiz ama güçlü bir tanıktır. Silent Witness. Mandelanın rakibi olan ve G. Afrikada görülen Botha davasında olduğu gibi 300 yıl önceki bir olayı aydınlatabilir. Nobel ödüllü James Watson, Afrikalıların değersiz ve düşük bir ırk olduğunu söyledi.

DNA'MIZ GERÇEKLERİ HAYKIRIYOR

Ama onun DNA’sı kendisinin köklerinin Afrika’dan geldiğini gösterince sesi kesildi! Artık elimizde X kromozomu, Y kromozomu ve mitokondri DNA’sı gibi ölüleri konuşturan, davaları aydınlatan çok güçlü sessiz genetik tanıklarımız var. Biz yalan veya çelişkili konuşsak bile DNA’mız gerçekleri haykırıyor.

Yorumlar (0)
12°
açık
Günün Anketi Tümü
En Çok Sevdiğiniz Renk Hangisi?
Namaz Vakti 13 Temmuz 2020
İmsak 05:46
Güneş 07:10
Öğle 13:18
İkindi 16:37
Akşam 19:16
Yatsı 20:35
Puan Durumu
Takımlar O P
1. Başakşehir 31 66
2. Trabzonspor 31 62
3. Sivasspor 32 57
4. Beşiktaş 31 53
5. Galatasaray 32 52
6. Alanyaspor 32 51
7. Fenerbahçe 32 50
8. Gaziantep FK 32 42
9. Antalyaspor 32 41
10. Göztepe 32 39
11. Kasımpaşa 32 39
12. Gençlerbirliği 32 36
13. Malatyaspor 31 32
14. Denizlispor 31 32
15. Çaykur Rizespor 32 32
16. Kayserispor 32 32
17. Konyaspor 31 30
18. Ankaragücü 32 29
Takımlar O P
1. Hatayspor 33 63
2. Erzurum BB 33 59
3. Adana Demirspor 33 58
4. Akhisar Bld.Spor 33 57
5. Bursaspor 33 56
6. Fatih Karagümrük 33 53
7. Altay 33 51
8. Keçiörengücü 33 47
9. Ümraniye 33 44
10. Giresunspor 33 44
11. Menemen Belediyespor 33 43
12. İstanbulspor 33 40
13. Balıkesirspor 33 38
14. Altınordu 33 36
15. Boluspor 33 30
16. Osmanlıspor 33 27
17. Adanaspor 33 21
18. Eskişehirspor 33 12
Takımlar O P
1. Liverpool 35 93
2. Man City 35 72
3. Chelsea 35 60
4. Leicester City 35 59
5. M. United 34 58
6. Wolverhampton 35 55
7. Sheffield United 35 54
8. Tottenham 35 52
9. Arsenal 35 50
10. Burnley 35 50
11. Everton 35 45
12. Southampton 34 44
13. Newcastle 35 43
14. Crystal Palace 35 42
15. Brighton 35 36
16. West Ham 35 34
17. Watford 35 34
18. Bournemouth 35 31
19. Aston Villa 35 30
20. Norwich City 35 21
Takımlar O P
1. Real Madrid 35 80
2. Barcelona 36 79
3. Atletico Madrid 36 66
4. Sevilla 36 66
5. Villarreal 35 57
6. Getafe 35 53
7. Athletic Bilbao 36 51
8. Real Sociedad 35 51
9. Valencia 36 50
10. Granada 35 50
11. Osasuna 36 48
12. Levante 36 43
13. Real Betis 36 41
14. Real Valladolid 36 39
15. Eibar 36 39
16. Celta de Vigo 36 36
17. Deportivo Alaves 35 35
18. Leganés 36 32
19. Mallorca 36 32
20. Espanyol 36 24
izmir escort escort izmir izmir escort escort antalya porno izle türk porno